WormBase Tree Display for RNAi: WBRNAi00106325
expand all nodes | collapse all nodes | view schema
WBRNAi00106325 | Homol | Homol_homol | F22B7:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | ATGTTTGTCTTAAACCGTTCAAGCGGGCTCATTCATCGATCTGTACCTTTATTAGCTCAAGTATCCACGCCTACGACTTCCACAACAAAATTAGCTCAACTTCACACAACGCATGCACTAAGCAAAGAAGATTATTATAAGACTTTGGGTGTCGACAAAAAATCTGATGCAAAAGCAATCAAAAAGGCTTATTTCCAGCTTGCCAAGAAATACCATCCAGATGTAAACAAAACAAAAGAAGCGCAGACGAAATTTCAAGAGATTTCTGAAGCATATGAGGTACTTTCCGATGACACAAAACGTCAAGAATATGATGCATACGGAAGCGGAGGTGGCCCAGCTGGTGGAAGAGGTGGTGCTGGAGGTTTCCACCACCATGGAAATGTTGATGTTAACGAAATTTTCAGAAGAGCATTTGGTGGAGGGGGTGGAATGGGTGGCTTTAATTTTGATAATTTTGCCCAAAGTGCTTTCGGACATTCTGCTGCTCAGGAAATGGTTATGGATATTTCGTTCGAAGAAGCTGTCCGAGGAGCCACCAAAAATGTTTCTGTAAACGTAGTTGAAGATTGTCTGAAATGTCACGGAACTCAAGTTGAACCAGGTCACAAAAAGACGTCGTGTCCGTATTGTAACGGAACTGGAGCAGTTTCTCAACGTCTTCAGGGTGGTTTCTTCTATCAAACAACTTGTAATCGATGCAGAGGAAGTGGACATTATAATAAGAATCCTTGTCAAGAATGTGAAGGTGAAGGTCAAACCGTTCAACGACGTCAAGTATCATTCAATGTGCCAGCTGGAACTAATAATGGAGATAGTTTGAAGTTCCAAGTGGGGAAAAATCAATTATTTGTTCGTTTCAACGTTGCACCATCTTTGAAATTCCGACGTGAGAAAGATGATATTCACTGTGACGTAGATATTTCTCTGGCTCAAGCTGTTCTTGGTGGTACTGTAAAGGTTCCTGGAATTAATGGAGATACATATGTTCATATTCCGGCAGGAACTGGCAGTCACACTAAAATGAGATTAACAGGAAAAGGAGTAAAACGATTGCATTCTTACGGAAATGGAGATCAATATATGCATATTAAAGTAACGGTTCCGAAATATTTGACAGCCGAACAGAAACAAATTATGTTGGCTTGGGCTGCGACGGAACAGCTGAAAGATGGAACCATCAAAGGATTGGAGAAAAATCAGAAAACCGAGGAGAAGGAGACGAAGAAAAATGAGGAAAAGAAGTCTGAAGGTGCATCAGAATCACAAAAACGGAGAAGTGAGCCAGTAGCTGAGAATGCAGAAACTATTGACGAAAATCAAGAAAACGAGGGATTTTTCGAAAAAATTAAACGAAAAATTTTCGGATAA | |||
Experiment | Strain | WBStrain00000001 | |||
Treatment | RNAi was introduced at the first larval stage of the C. elegans life cycle (L1) and its effects were examined after 5 days at 15 degrees Celsius (or after 3 days at 20 degrees Celsius), until animals grown on control RNAi reached adulthood (Table 1). | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | F22B7.5a | Inferred_automatically | RNAi_primary | |
F22B7.5b | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00001028 | Inferred_automatically | RNAi_primary | ||
Transcript | F22B7.5a.1 | Inferred_automatically | RNAi_primary | ||
F22B7.5b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00046852 | ||||
Phenotype_not_observed | WBPhenotype:0000059 | Remark | "... we first compiled a list of C-elegans chaperones (97 genes) (Table 1) and examined the effects of down-regulation of each chaperone in wild-type animals (Figure 2A). Down-regulation of genes encoding 10 chaperones (17 genes), including CTT, HSP-1 (Hsc70/HSPA8), HSP-4 (BIP), HSP-6 (Mortalin), and DAF-21 (Hsp90), resulted in severe organismal phenotypes, such as lethality, developmental arrest, or sterility (Table 1, Figure S2). In contrast, downregulation of genes encoding most chaperones examined had no apparent phenotypes (Table 1). Our data are in agreement with published RNAi screens for wild-type RNAi treatment (Table 1, data curated by wormbase). When knockout mutants or data from enhanced RNAi efficacy experiments, (for example via dsDNA [sic] injection into the gonads) were considered, more acute phenotypes were observed for some chaperones (Table 1, data curated by wormbase)." | ||
WBPhenotype:0000643 | Remark | "... we first compiled a list of C-elegans chaperones (97 genes) (Table 1) and examined the effects of down-regulation of each chaperone in wild-type animals (Figure 2A). Down-regulation of genes encoding 10 chaperones (17 genes), including CTT, HSP-1 (Hsc70/HSPA8), HSP-4 (BIP), HSP-6 (Mortalin), and DAF-21 (Hsp90), resulted in severe organismal phenotypes, such as lethality, developmental arrest, or sterility (Table 1, Figure S2). In contrast, downregulation of genes encoding most chaperones examined had no apparent phenotypes (Table 1). Our data are in agreement with published RNAi screens for wild-type RNAi treatment (Table 1, data curated by wormbase). When knockout mutants or data from enhanced RNAi efficacy experiments, (for example via dsDNA [sic] injection into the gonads) were considered, more acute phenotypes were observed for some chaperones (Table 1, data curated by wormbase)." | |||
WBPhenotype:0000688 | Remark | "... we first compiled a list of C-elegans chaperones (97 genes) (Table 1) and examined the effects of down-regulation of each chaperone in wild-type animals (Figure 2A). Down-regulation of genes encoding 10 chaperones (17 genes), including CTT, HSP-1 (Hsc70/HSPA8), HSP-4 (BIP), HSP-6 (Mortalin), and DAF-21 (Hsp90), resulted in severe organismal phenotypes, such as lethality, developmental arrest, or sterility (Table 1, Figure S2). In contrast, downregulation of genes encoding most chaperones examined had no apparent phenotypes (Table 1). Our data are in agreement with published RNAi screens for wild-type RNAi treatment (Table 1, data curated by wormbase). When knockout mutants or data from enhanced RNAi efficacy experiments, (for example via dsDNA [sic] injection into the gonads) were considered, more acute phenotypes were observed for some chaperones (Table 1, data curated by wormbase)." | |||
Remark | (Table 1) dnj-10 RNAi. Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
Method | RNAi |