WormBase Tree Display for RNAi: WBRNAi00108174
expand all nodes | collapse all nodes | view schema
| WBRNAi00108174 | Homol | Homol_homol | K02F3:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | cagtcttcaaatggatcatatgattttctaacaagtcgccctttcgacgtcctgtcaatgcaatgtgtgatcaaaaagaaaactccgcttatcaatcttcaattcttatcaaatgacgttatgaagaattgaagcaaaagtccaatgtgcgattgtttaaatggaatgtatatgttctatgaagttgttattatacctatgtgttaaattcaaatatcgaaaataagcaaatgttaataaatttgctcatagaacgcacaagtaatgagttcacaccatatcttgtctgtatataaaaattc | |||
| Experiment | Genotype | Daf-16::GFP | |||
| Treatment | Animals exposed to 100 mg/L graphene oxide. | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Gene | WBGene00019327 | Inferred_automatically | RNAi_primary | |
| WBGene00219709 | Inferred_automatically | RNAi_primary | |||
| Transcript | K02F3.4.3 | Inferred_automatically | RNAi_primary | ||
| K02F3.14 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00049772 | ||||
| Phenotype | WBPhenotype:0000679 | Remark | RNAi knockdown of linc-37 not only increased the DAF-16::GFP expression, but also enhance the translocation of DAF-16::GFP into the nucleus of intestinal cells. | ||
| Remark | Exact sequence used for RNAi not stated by authors, putative transcript sequence of gene used for curation. | ||||
| Method | RNAi |
