WormBase Tree Display for RNAi: WBRNAi00113991
expand all nodes | collapse all nodes | view schema
| WBRNAi00113991 | Homol | Homol_homol | K08F8:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gaacctccaagtatgagcgcagagctggtgtacgcaccgatggtcactcgcaacttctactcggcgccgcatcgaacatttggtaccttggctcagaaagtggttgacaaacgaccttctcaatttgcaatcccttcaacatcaacagcagctcatcctggattgactacacctatggcatcaattttccaatcacccacaatgccacctccacataccccatcacctttttctgctggtccaatgagtcatcatccaatgggaccacctgcgtatccaggaactcctggctcatttccaccaacaacgccaacatatcctggaatgacaccacgaccagggccaaactttggacctcctggtccagtctatccaaactctcaacaaatgatgggcccgggtggatatccaccacaaatgggtatgataaactctcaacggcatttccaaaatcagcagatgtatcaacagcaaatggtgagaatgcagcaaatgcgccagatgggtggacctccagggtatggtgcacctggtgtatctccttatcaacaggttaacgcaattacaagtccagcaggatttggaatgccacccaacggtccgtcttctgttcaaaggcttaacaattttgttaatcaatcacaattcggcccgaacaatggtcatccaacaccaccgtacggttatatgcaacaaatgattccacaatcaccaaacttcaatcaacagtacaatggaatgggaaatcaactaatgagtccaatacatcaacaccaattccatcagcaacaaatggttcagcagcagcagcaacaacaaatgcagatgcatagacaacagatgcagatgcaaaatcaaaatatgtcccaaccgttccaaccaccaactgctcaaatgttacaaatgcagcaaaatgagcaaatgagaatagcctt | |||
| Experiment | Strain | WBStrain00047120 | |||
| Treatment | Embryonic lethality was scored by imaging a well of 50-100 embryos at 10x magnification. When 20% or more of the embryos exhibited embryonic lethality, the RNAi was scored as embryonic lethal. All other phenotypes scored at 60x magnification during the first 10 hours of embryonic development. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | K08F8.6 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00002295 | Inferred_automatically | RNAi_primary | ||
| Transcript | K08F8.6.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00056424 | ||||
| Phenotype | WBPhenotype:0000050 | Remark | Enclosure defect, 2-Fold arrest | ||
| WBPhenotype:0000367 | Remark | Enclosure defect, 2-Fold arrest | |||
| WBPhenotype:0000368 | Remark | Enclosure defect, 2-Fold arrest | |||
| WBPhenotype:0000494 | Remark | Enclosure defect, 2-Fold arrest | |||
| WBPhenotype:0001908 | Remark | Enclosure defect, 2-Fold arrest | |||
| Remark | (Table S2) let-19 RNAi | ||||
| Method | RNAi |
