WormBase Tree Display for Sequence: Y60A3A
expand all nodes | collapse all nodes | view schema
Y60A3A | DNA | Y60A3A | 122592 | ||
---|---|---|---|---|---|
SMap | S_child (12) | ||||
Structure | From | Source | CHROMOSOME_V | ||
Overlap_right | Y113G7A | 122480 | |||
Overlap_left | Y116F11B | ||||
Clone_left_end | Y60A3 | 1 | |||
Y102G3 | 3623 | ||||
Y113G7 | 47717 | ||||
Y60A3A | 1 | ||||
Clone_right_end | Y116F11 | 47722 | |||
Y60A3 | 122592 | ||||
Y60A3A | 122592 | ||||
DB_info | Database | EMBL | NDB_AC | AL117207 | |
NDB_SV | AL117207.1 | ||||
Secondary_accession | AL021574 | ||||
Keyword | HTG | ||||
EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | |||
Origin | From_author | Williams L | |||
From_laboratory | HX | ||||
Date_directory | 990420 | ||||
Species | Caenorhabditis elegans | ||||
Strain | WBStrain00000001 | ||||
Visible | Clone | Y60A3A | |||
Properties | Genomic_canonical | ||||
Checksum | MD5 | fab5f6521fe22b826a8c79652f04f634 | |||
Status | Finished | 20 Apr 1999 00:00:00 | |||
Submitted | 20 Apr 1999 00:00:00 | ||||
Annotated | 21 Oct 1999 00:00:00 | ||||
Map | Sequence-V | Ends (2) | |||
Interpolated_map_position | V | 24.1276 | |||
Assembly_tags | Finished Left | 1 | 4 | Y60A3A | |
Clone left end | 1 | 6 | Y60A3 | ||
3623 | 3628 | Y102G3 | |||
47717 | 47722 | Y113G7 | |||
Warning | 21033 | 21033 | |||
29851 | 29851 | Y102G3 base diff | |||
35625 | 35625 | poss base diff | |||
annotation | 21032 | 21034 | First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[X] OtherAdd a comment here -Clone Y16F11 reads aTg at this point, but reads have been edited to the sequence of this clone. | ||
23366 | 23406 | First select a Feature - [ ] Unsure [X] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [X] Single clone region [ ] Forced join [ ] Other Add a comment here - Region contains only sonicated reads from subclone Y60A3_2e7. | |||
30105 | 29199 | First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Region contains a tandem repeat element which is 32bp long. There is some variation in the copies. | |||
64373 | 65119 | First select a Feature - [ ] Unsure [X] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [X] Single clone region [ ] Forced join [ ] Other Add a comment here - Region only contains sonicated reads from subclone vw64a10. | |||
65162 | 65196 | First select a Feature - [ ] Unsure [X] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [X] Single clone region [ ] Forced join [ ] Other Add a comment here - Region only contains sonicated reads from subclone vw64a10. | |||
65271 | 65348 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ ] Single clone region[ ] Forced join[x] OtherAdd a comment here -This region is the loop of an inverted repeat, the arms of which are approximately 2.7kb. Because the subclones used have an insert size of 1.5kb, orientation of this sequence is unconfirmed. | |||
98780 | 98821 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Suclones in this region show some rearangement. | |||
Finisher comment | 21032 | 21034 | reads from Y116F11 read aTg but both Y102G3 and Y60A3 read aCg edited to majority | ||
35626 | 35624 | Single subclone fron Y102G3 does not have the A. | |||
63172 | 63177 | single direction terms | |||
64521 | 64668 | single direction terms | |||
80230 | 80596 | Only reads from Y102G3 and F43A2 | |||
oligo | 23291 | 23271 | serial#= Y60A3.1 template= sequence=CACATGGTTACATCATTTTTG flags= | ||
23469 | 23486 | serial#=Y60A3.2 template= sequence=CTCGGAGCCAATTTTATC flags= | |||
comment | 23627 | 23630 | clipped to allow join | ||
24463 | 24438 | ? | |||
25403 | 25386 | ?start of match with t08d2 | |||
26238 | 26240 | ? | |||
26551 | 26556 | cut back poss chimeric | |||
29549 | 29553 | Some reads gttta some reads gtcta Therefore one set needs pulling out | |||
47457 | 47454 | Cipped read poss chimeric. | |||
47952 | 47957 | Reads 3330, 2666 and 187 ttcttct the rest say.... tttttct | |||
60427 | 60428 | ? | |||
63607 | 63613 | Some reads are calling gagaacc and some are calling gagcacc Could be repeat left in situ for now ! | |||
65651 | 65648 | End of vw64a10 sil | |||
105338 | 105331 | Not sure about number of g and c's. Edited through by hand, moe work needs doing. | |||
117226 | 117226 | ? | |||
cosmid vector | 23860 | 23784 | |||
23788 | |||||
23857 | 23804 | ||||
Direct Repeat | 29215 | 29199 | |||
29756 | 29725 | ||||
30042 | 30011 | ||||
29915 | 29884 | ||||
29819 | 29788 | ||||
30010 | 29979 | ||||
29883 | 29852 | ||||
29978 | 29947 | ||||
30105 | 30075 | ||||
30074 | 30043 | ||||
Polymorphism | 30118 | 30106 | breakpoint of repeat | ||
Inverted Repeat | 47445 | 47448 | |||
48361 | |||||
47364 | 47367 | ||||
22263 | 22376 | ||||
22531 | 22645 | ||||
46452 | 47368 | ||||
62513 | 65271 | ||||
65349 | 65349 | ||||
65350 | 68107 | ||||
Clone right end | 47717 | 47722 | Y116F11 | ||
122587 | 122592 | Y60A3 | |||
compression | 67919 | 67919 | |||
62690 | 62699 | other arm has 9 t's at this point | |||
65261 | 65261 | ||||
65264 | 65264 | ||||
65355 | 65355 | ||||
65358 | 65358 | ||||
67920 | 67920 | other arm of repeat has 10 A's at this point | |||
TeamLeader comment | 98777 | 98831 | for john to check | ||
Finished Right | 122589 | 122592 | Y60A3A | ||
repeat | 45641 | 45486 | |||
46225 | 45642 | ||||
Method | Genomic_canonical |