WormBase Tree Display for Sequence: Y106G6E
expand all nodes | collapse all nodes | view schema
Y106G6E | DNA | Y106G6E | 37704 | ||
---|---|---|---|---|---|
SMap | S_child (12) | ||||
Structure | From | Source | CHROMOSOME_I | ||
Overlap_right | ZC247 | 37599 | |||
Overlap_left | C25A1 | ||||
Clone_left_end (2) | |||||
Clone_right_end | C25A1 | 104 | |||
Y106G6E | 37704 | ||||
DB_info | Database | EMBL | NDB_AC | AL032656 | |
NDB_SV | AL032656.3 | ||||
Secondary_accession | Z98856 | ||||
Keyword | HTG | ||||
EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | |||
Origin | From_author | McMurray AA | |||
From_laboratory | HX | ||||
Date_directory | 011009 | ||||
Species | Caenorhabditis elegans | ||||
Strain | WBStrain00000001 | ||||
Visible | Clone | Y106G6E | |||
Expr_pattern | |||||
Properties | Genomic_canonical | ||||
Checksum | MD5 | 52f4ec7a7ce92918f64069f6aea2e0dc | |||
Status | Finished | 17 Aug 1998 00:00:00 | |||
Submitted | 29 Oct 1998 00:00:00 | ||||
Annotated | 01 Jan 1980 00:00:00 | ||||
Map | Sequence-I | Ends | Left | 4953 | |
Right | 4973 | ||||
Interpolated_map_position | I | 4.75504 | |||
Assembly_tags | Finished Left | 1 | 4 | Y106G6E | |
Clone right end | 101 | 104 | C25A1 | ||
Finished Right | 37701 | 37704 | Y106G6E | ||
Clone left end | 37599 | 37604 | ZC247 | ||
annotation | 4428 | 19494 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[x] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Tandem repeat (typical repeat element ATTGTCAACTGAATAGGTTGATTTGTGTTTTCTTTAAAATTTTTAAAAATTTGGTAAAAGAAAACC). Size unknown. | ||
25718 | 25815 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - | |||
29946 | 30112 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - | |||
33933 | 34367 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - single sonicated clone | |||
30040 | 30040 | G->A based on Thierry-Mieg EST analysis | |||
30045 | 30045 | C->G based on Thierry-Mieg EST analysis | |||
30051 | 30051 | A->T based on Thierry-Mieg EST analysis | |||
30078 | 30078 | A->T based on Thierry-Mieg EST analysis | |||
Method | Genomic_canonical |