WormBase Tree Display for Sequence: Y48C3A
expand all nodes | collapse all nodes | view schema
| Y48C3A | DNA | Y48C3A | 165027 | ||
|---|---|---|---|---|---|
| SMap | S_child (12) | ||||
| Structure | From | Source | CHROMOSOME_II | ||
| Overlap_right | Y48E1C | 164928 | |||
| Overlap_left | F15D4 | ||||
| Clone_left_end | Y48E1 | 164928 | |||
| Y48C3A | 1 | ||||
| Clone_right_end | F15D4 | 100 | |||
| Y48C3A | 165027 | ||||
| DB_info | Database | EMBL | NDB_AC | AL117203 | |
| NDB_SV | AL117203.2 | ||||
| Secondary_accession | Z92855 | ||||
| DB_remark | [121025] Sequence correction: SNP 0 bases @ 94674 | ||||
| [121025] Sequence correction: SNP 0 bases @ 122898 | |||||
| Keyword | HTG | ||||
| EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | |||
| Origin | From_author | Wallis JM | |||
| From_laboratory | HX | ||||
| Date_directory | 990528 | ||||
| Species | Caenorhabditis elegans | ||||
| Strain | WBStrain00000001 | ||||
| Visible | Clone | Y48C3A | |||
| Remark | Transposon Y48C3A.21 converted into an S_Child [020208 kj] | ||||
| Properties | Genomic_canonical | ||||
| Checksum | MD5 | 03f90cc32387452c83190ec2767aa94a | |||
| Status | Finished | 28 May 1999 00:00:00 | |||
| Submitted | 28 May 1999 00:00:00 | ||||
| Annotated | 28 Oct 1999 00:00:00 | ||||
| Map | Sequence-II | Ends | Left | 7687 | |
| Right | 7785 | ||||
| Interpolated_map_position | II | 16.676 | |||
| Assembly_tags | Clone right end | 97 | 100 | F15D4 | |
| Finished Left | 1 | 4 | Y48C3A | ||
| annotation | 122848 | 122963 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[x] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Sequence from terminator read from a pUC clone, forming part of one arm of an inverted repeat. | ||
| 150198 | 150339 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - | |||
| 150348 | 150375 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Weak double stranding | |||
| 63692 | 64681 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[x] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Size unknown. Each element 20 bases, typical sequence:AAAATTTGAATTTTTAAGTC | |||
| 64529 | 66101 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Deleted in Y48C3, present in Y81G3 | |||
| 71756 | 72061 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[x] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Sequence from reads from a short insert library derived from a single pUC clone. | |||
| 128455 | 128597 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[x] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Sequence from reads from a short insertlibrary derived from a single pUC clone,forming part of an inverted repeat. | |||
| 128554 | 128554 | First select a Feature - [x] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - In arm of inverted repeat. | |||
| 128571 | 128571 | First select a Feature - [x] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - In arm of inverted repeat. | |||
| Finished Right | 165027 | 165024 | Y48C3A | ||
| Clone left end | 164928 | 164933 | Y48E1 | ||
| Method | Genomic_canonical |
