WormBase Tree Display for Sequence: Y49A3A
expand all nodes | collapse all nodes | view schema
| Y49A3A | DNA | Y49A3A | 10564 | |||
|---|---|---|---|---|---|---|
| SMap | S_child | Gene_child | WBGene00013025 | 3582 | 6295 | |
| WBGene00194686 | 1572 | 1257 | ||||
| WBGene00000877 | 7949 | 8695 | ||||
| WBGene00013026 | 6283 | 7614 | ||||
| CDS_child (93) | ||||||
| Transcript | Y49A3A.6 | 1572 | 1257 | |||
| Y49A3A.2.1 | 3582 | 6295 | ||||
| Y49A3A.3.1 | 6283 | 7614 | ||||
| Y49A3A.5.1 | 7949 | 8695 | ||||
| PCR_product (16) | ||||||
| Allele (144) | ||||||
| Oligo_set | Aff_Y49A3A.A | 1823 | 2766 | |||
| Aff_Y49A3A.B | 4055 | 4935 | ||||
| Aff_Y49A3A.C | 5192 | 5791 | ||||
| Aff_Y49A3A.D | 7953 | 8595 | ||||
| Aff_Y49A3A.E | 10091 | 8773 | ||||
| Feature_object (299) | ||||||
| Feature_data | Y49A3A:Polysome | 1 | 10564 | |||
| Y49A3A:TranscriptionallyActiveRegion | 1 | 10564 | ||||
| Y49A3A:ChIPSeqTF | 1 | 10564 | ||||
| Y49A3A:TRF | 1 | 10564 | ||||
| Y49A3A:Dust | 1 | 10564 | ||||
| Y49A3A:inverted | 1 | 10564 | ||||
| Homol_data (20) | ||||||
| Structure | From | Source | CHROMOSOME_V | |||
| Overlap_right | F56A12 | 10461 | ||||
| Overlap_left | F47B8 | |||||
| Clone_left_end | F56A12 | 10461 | ||||
| Y49A3A | 1 | |||||
| Clone_right_end | Y49A3A | 10564 | ||||
| DB_info | Database | EMBL | NDB_AC | AL033512 | ||
| NDB_SV | AL033512.1 | |||||
| Secondary_accession | AL023793 | |||||
| Keyword | HTG | |||||
| EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | ||||
| Origin | From_author | McMurray AA | ||||
| From_laboratory | HX | |||||
| Date_directory | 981023 | |||||
| Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00000001 | |||||
| Visible | Clone | Y49A3A | ||||
| Properties | Genomic_canonical | |||||
| Checksum | MD5 | 9dfe25d953bb87b473df0d6b0179e690 | ||||
| Status | Finished | 23 Oct 1998 00:00:00 | ||||
| Submitted | 12 Nov 1998 00:00:00 | |||||
| Annotated | 01 Jan 1980 00:00:00 | |||||
| Map | Sequence-V | Ends | Left | 8129 | ||
| Right | 8145 | |||||
| Interpolated_map_position | V | 6.24981 | ||||
| Assembly_tags | Finished Left | 1 | 4 | Y49A3A | ||
| Finished Right | 10561 | 10564 | Y49A3A | |||
| Clone left end | 10461 | 10464 | F56A12 | |||
| annotation | 56 | 502 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[x] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here -tandem repeat with typical repeat element GATCAGAACATCAGAAGGTACCCATGT (270-mer). Size not determined. | |||
| 324 | 331 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [x] Forced join [ ] Other Add a comment here - in tandem repeat region | ||||
| Method | Genomic_canonical |
