WormBase Tree Display for Sequence: ZC410

ZC410 DNA: ZC410 28928
  SMap: S_child: Gene_child: WBGene00003610 3852 7471
        WBGene00013881 12418 10350
        WBGene00303009 28305 27412
        WBGene00173607 14129 14149
        WBGene00013880 8522 10420
        WBGene00003066 27881 26022
        WBGene00013882 22443 26045
        WBGene00220234 13308 13059
        WBGene00006663 16204 21428
      CDS_child (334)
      Transcript (18)
      Nongenomic: yk150h7 22499 25971
        yk342h12 26189 28280
      PCR_product (26)
      Allele (361)
      Oligo_set: Aff_C01F6.8 29476 28554
        Aff_ZC410.1 6258 7369
        Aff_ZC410.2 9594 10347
        Aff_ZC410.3 11084 10443
        Aff_ZC410.4 19430 21191
        Aff_ZC410.5 22460 25874
        Aff_ZC410.6 1063 1470
        Aff_ZC410.7 28347 27824
      Feature_object (351)
      Feature_data: ZC410:Polysome 1 28928
        ZC410:TranscriptionallyActiveRegion 1 28928
        ZC410:ChIPSeqTF 1 28928
        ZC410:TRF 1 28928
        ZC410:Dust 1 28928
        ZC410:inverted 1 28928
      Homol_data (19)
  Structure: From: Source: CHROMOSOME_IV
    Overlap_right: C01F6 28825
    Overlap_left: Y73F4A
    Clone_left_end: ZC410 1
      C01F6 28825
  DB_info: Database: EMBL NDB_AC Z68270
        NDB_SV Z68270.2
    Keyword: HTG
    EMBL_dump_info: EMBL_dump_method: worm_EMBL-dump
  Origin: From_author: McMurray AA
    From_laboratory: HX
    Date_directory: 991025
    Species: Caenorhabditis elegans
    Strain: WBStrain00000001
  Visible: Clone: ZC410
  Properties: Genomic_canonical
    Checksum: MD5: 7551bde6763499c91ac0c9c357dfe34f
    Status: Finished: 29 Sep 1995 00:00:00
      Submitted: 17 Dec 1995 00:00:00
      Annotated: 11 Dec 1995 00:00:00
  Map: Sequence-IV Ends: Left: 4548
        Right: 4566
  Interpolated_map_position: IV 4.02585
  Assembly_tags: annotation 26 1434 From almost the beginning of the cosmid cloning site to 1.435bp, multiple (approx 95) copies of a 15mer (RcD1) with the following variations: GATGGGTCTCACCAC GAAGGGTCTCACCAC AATGGGTCTCACCAC GAAAGGTCTCAATAC GAAGGGTGTCACCAC GAAAGGTCTCGCCAC GAAGGGTCTCGCCAC *A**GGT*TC***AC = CONSENSUS SEQUENCE (REF: Naclerio et al. (1992) J.Mol.Biol. vol.226 pp.159-168) We have been unable to obtain either cosmid or genomic PCR products across this region. However, restriction digest data suggests fragment sizes (from cosmid DNA) of 1.8kb from SspI- cut DNA and about 2kb from Sau3AI-cut DNA. This agrees approx. with the given sequence here. Because of the repetitive nature of this sequence, we cannot guarantee base accuracy across this region.
          From almost the beginning of thecosmid cloning site to 1.435bp,multiple (approx 95) copies of a 15mer(RcD1) with the following variations:GATGGGTCTCACCACGAAGGGTCTCACCACAATGGGTCTCACCACGAAAGGTCTCAATACGAAGGGTGTCACCACGAAAGGTCTCGCCACGAAGGGTCTCGCCAC*A**GGT*TC***AC = CONSENSUS SEQUENCE(REF: Naclerio et al. (1992)J.Mol.Biol. vol.226 pp.159-168)We have been unable to obtain eithercosmid or genomic PCR products acrossthis region. However, restrictiondigest data suggests fragment sizes(from cosmid DNA) of 1.8kb from SspI-cut DNA and about 2kb from Sau3AI-cutDNA. This agrees approx. with thegiven sequence here.Because of the repetitive nature ofthis sequence, we cannot guaranteebase accuracy across this region.
    Clone left end 1 6 Start of ZC410
          ZC410
      28825 28828 left hand end of C01F6
          C01F6
    Finished Left 1 6 ZC410
    Finished Right 28925 28928 ZC410
  Method: Genomic_canonical