WormBase Tree Display for Strain: WBStrain00005108
expand all nodes | collapse all nodes | view schema
| WBStrain00005108 | Status | Live | ||
|---|---|---|---|---|
| Genotype | smg-1(cc546) I; dvIs75. | |||
| Public_name | CL2621 | |||
| Contains | Gene | WBGene00004879 | ||
| Variation | WBVar00051557 | |||
| Transgene | WBTransgene00016354 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | UV | |||
| CGC_received | 05 Jan 2012 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson376 | |||
| Remark | dvIs75 [myo-3::Abeta 1-42 G37L::3' UTR(long) + mtl-2::GFP)]. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in ~32 hr if induced as L3 larvae. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] | Inferred_automatically | From CGC strain data | |
| Species | Caenorhabditis elegans |
