WormBase Tree Display for Strain: WBStrain00027461
expand all nodes | collapse all nodes | view schema
WBStrain00027461 | Status | Live | ||
---|---|---|---|---|
Genotype | mir-51(n4473) IV. | |||
Public_name | MT14450 | |||
Contains | Gene | WBGene00003279 | ||
Variation | WBVar00090844 | |||
Properties | Outcrossed | x0 | ||
Mutagen | DEB | |||
CGC_received | 16 Nov 2007 00:00:00 | |||
Location | CGC | |||
Remark | Deletion breakpoints are: TTTGAATGAATATCTGGTTACCAAAA / CAATTACCA...CCAAAACATACGGT / TGTGAAAGGAAAGAAAAGCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. | Inferred_automatically | From CGC strain data | |
Made_by: Horvitz Lab Members | CGC_data_submission | |||
Species | Caenorhabditis elegans |