WormBase Tree Display for Strain: WBStrain00030607
expand all nodes | collapse all nodes | view schema
| WBStrain00030607 | Status | Live | ||
|---|---|---|---|---|
| Genotype | smg-1(cc546) unc-54(r293) I. | |||
| Public_name | PD8118 | |||
| Contains | Gene | WBGene00004879 | ||
| WBGene00006789 | ||||
| Variation | WBVar00241309 | |||
| WBVar00051557 | ||||
| Properties | CGC_received | 23 Apr 1997 00:00:00 | ||
| Location | CGC | |||
| Remark | Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] | Inferred_automatically | From CGC strain data | |
| Species | Caenorhabditis elegans |
