WormBase Tree Display for Strain: WBStrain00030608
expand all nodes | collapse all nodes | view schema
| WBStrain00030608 | Status | Live | ||
|---|---|---|---|---|
| Genotype | smg-1(cc545) I. | |||
| Public_name | PD8119 | |||
| Contains | Gene | WBGene00004879 | ||
| Variation | WBVar00051552 | |||
| Properties | Outcrossed | x2 | ||
| Mutagen | EMS | |||
| CGC_received | 23 Apr 1997 00:00:00 | |||
| Location | CGC | |||
| Remark | Made_by: Getz and Fire | CGC_data_submission | ||
| Temperature sensitive. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).] | Inferred_automatically | From CGC strain data | ||
| Species | Caenorhabditis elegans |
