WormBase Tree Display for Strain: WBStrain00032881
expand all nodes | collapse all nodes | view schema
| WBStrain00032881 | Status | Live | ||
|---|---|---|---|---|
| Genotype | gst-24(ok2980) II. | |||
| Public_name | RB2200 | |||
| Contains | Gene | WBGene00001772 | ||
| Variation | WBVar00094067 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | EMS | |||
| CGC_received | 02 Apr 2008 00:00:00 | |||
| Location | CGC | |||
| Remark | This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |
| F37B1.1 Homozygous. Outer Left Sequence: gcgacgattcatggtctttt. Outer Right Sequence: ctctccctcccctcaatttc. Inner Left Sequence: caaactccccaggtgtgact. Inner Right Sequence: ggagattttcgaaacgactttg. Inner Primer PCR Length: 1156. Deletion size: about 600 bp. ttggtcagctcccattcctc [ 603 bp deletion] caagttatctaggcacgagg -- Wild type ttggtcagctcccattcctc ------------------ caagttatctaggcacgagg -- ok2980 Sequence shown is on the minus strand. Deletion starts in the second exon and removes the downstream part of that exon, the 3'-UTR, and approximately 0.1 kb of downstream flanking sequence. | Inferred_automatically | From CGC strain data | ||
| Made_by: OMRF Knockout Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
