WormBase Tree Display for Strain: WBStrain00034104
expand all nodes | collapse all nodes | view schema
WBStrain00034104 | Status | Live | ||
---|---|---|---|---|
Genotype | smg-1(cc546) I; pha-4(zu225) V. | |||
Public_name | SM190 | |||
Contains | Gene | WBGene00004013 | ||
WBGene00004879 | ||||
Variation | WBVar00051557 | |||
WBVar00275534 | ||||
Properties | Outcrossed | x>4 | ||
Mutagen | EMS | |||
CGC_received | 29 Aug 2008 00:00:00 | |||
Location | CGC | |||
Remark | Made_by: Mary Ellen Domeier | CGC_data_submission | ||
WBStrain mapped, WBPaper00059578 added based on AFP_Strain data. | Curator_confirmed | WBPerson1983 | ||
Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] | Inferred_automatically | From CGC strain data | ||
Reference | WBPaper00059578 | |||
Species | Caenorhabditis elegans |