WormBase Tree Display for Strain: WBStrain00034457
expand all nodes | collapse all nodes | view schema
WBStrain00034457 | Status | Live | ||
---|---|---|---|---|
Genotype | klp-19(bn126)/mT1 [dpy-10(e128)] III. | |||
Public_name | SS746 | |||
Contains | Gene | WBGene00001072 | ||
WBGene00002229 | ||||
Variation | WBVar00142982 | |||
WBVar00000502 | ||||
Rearrangement | mT1 | |||
Properties | Outcrossed | x7 | ||
Mutagen | UV+TMP | |||
CGC_received | 12 Mar 2005 00:00:00 | |||
Location | CGC | |||
Made_by | WBPerson4124 | |||
Remark | Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2. | Inferred_automatically | From CGC strain data | |
Mutagen:UV/TMP | Curator_confirmed | WBPerson1983 | ||
Species | Caenorhabditis elegans |