WormBase Tree Display for Strain: WBStrain00047536
expand all nodes | collapse all nodes | view schema
WBStrain00047536 | Status | Live | ||
---|---|---|---|---|
Genotype | pry-1(gk3681[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I; F56E10.1(gk3701) V. | |||
Public_name | VC3709 | |||
Contains | Gene | WBGene00003514 | ||
WBGene00004202 | ||||
WBGene00004496 | ||||
WBGene00006789 | ||||
WBGene00018975 | ||||
Variation | WBVar02153585 | |||
WBVar02157315 | ||||
Properties | Outcrossed | x0 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 05 Nov 2019 00:00:00 | |||
Location | CGC | |||
Remark | Homozygous viable. Deletion of 720 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAGGGGCCCCTCCCGGTAGCCGGTCGAGCG; Right flanking sequence: GGATTTTTCTGCGAAATTTGGATTTAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
Made_by: Vancouver KO Group | CGC_data_submission | |||
Homozygous viable. Primary deletion of 720 bp in pry-1 with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAGGGGCCCCTCCCGGTAGCCGGTCGAGCG; Right flanking sequence: GGATTTTTCTGCGAAATTTGGATTTAGCTT. Strain carries secondary 5-bp deletion in F56E10.1, with flanking sequences GGCGCCGGCGGTGAAGAGGATGAGGACAAT and GGATTCAGAAGAAGAAGATGAAGAAGACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | ||
Species | Caenorhabditis elegans |