WormBase Tree Display for Strain: WBStrain00051632
expand all nodes | collapse all nodes | view schema
| WBStrain00051632 | Status | Live | ||
|---|---|---|---|---|
| Genotype | lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. | |||
| Public_name | CGC177 | |||
| Contains | Gene | WBGene00001072 | ||
| WBGene00002957 | ||||
| WBGene00002993 | ||||
| Variation | WBVar00142982 | |||
| Rearrangement | mIn1 | |||
| Transgene | WBTransgene00024163 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 14 Feb 2022 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson4823 | |||
| Remark | umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC. | Inferred_automatically | From CGC strain data | |
| Species | Caenorhabditis elegans |
