WormBase Tree Display for Strain: WBStrain00051686
expand all nodes | collapse all nodes | view schema
WBStrain00051686 | Status | Live | ||
---|---|---|---|---|
Genotype | muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. | |||
Public_name | GLW27 | |||
Contains | Gene | WBGene00001946 | ||
WBGene00006843 | ||||
Variation | WBVar00145093 | |||
Transgene | WBTransgene00032981 | |||
Properties (3) | ||||
Location | CGC | |||
Remark | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26 | Inferred_automatically | From CGC strain data | |
Made_by: Ella DeMott (Glow Worms '20) | CGC_data_submission | |||
Species | Caenorhabditis elegans |