Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Strain: WBStrain00051687

expand all nodes | collapse all nodes | view schema

Name Class

WBStrain00051687StatusLive
GenotypemuIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V.
Public_nameGLW29
Contains (3)
PropertiesOutcrossedx0
MutagenCRISPR_Cas9
CGC_received21 Dec 2021 00:00:00
LocationCGC
RemarkmuIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.Inferred_automaticallyFrom CGC strain data
Made_by: Ella DeMott (Glow Worms '20)CGC_data_submission
SpeciesCaenorhabditis elegans