Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Strain: WBStrain00055192

expand all nodes | collapse all nodes | view schema

Name Class

WBStrain00055192Genotypesrc-1(ccp1[src-1::gfp]) I; unc-119(ed3) III; ltIs37 IV.
Public_namePLG1
Contains (3)
PropertiesOutcrossedx0
MutagenCRISPR_Cas9
CGC_received14 Feb 2023 00:00:00
LocationCGC
RemarkltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted at 3' end of endogenous src-1 locus using CRISPR/Cas9 engineering. gRNA sequence: AGCACAATTTTTTAGGCACTInferred_automaticallyFrom CGC strain data
Made_by: Maria Andrade-LudenaCGC_data_submission
SpeciesCaenorhabditis elegans