WormBase Tree Display for Strain: WBStrain00055325
expand all nodes | collapse all nodes | view schema
| WBStrain00055325 | Genotype | him-5(e1490) V; seb-3(sy1794) X. | ||
|---|---|---|---|---|
| Public_name | PS9496 | |||
| Contains | Gene | WBGene00001864 | ||
| WBGene00007664 | ||||
| Variation | WBVar00144039 | |||
| WBVar02159080 | ||||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 15 Jun 2022 00:00:00 | |||
| Location | CGC | |||
| Remark | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of seb-3 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATTGAAAAAACTGGAAAACAGTTCGTATAATCCG right flanking sequence: GGgtgggtcaagttccagtgttcagtttttttaaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAGTTCGTATAATCCGGGG Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616 | Inferred_automatically | From CGC strain data | |
| Made_by: Heenam Park | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
