WormBase Tree Display for Strain: WBStrain00055334
expand all nodes | collapse all nodes | view schema
WBStrain00055334 | Genotype | him-5(e1490) V; nlp-49(sy1815) X. | ||
---|---|---|---|---|
Public_name | PS9529 | |||
Contains | Gene | WBGene00001864 | ||
WBGene00019160 | ||||
Variation | WBVar00144039 | |||
WBVar02159089 | ||||
Properties | Outcrossed | x0 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 02 Aug 2023 00:00:00 | |||
Location | CGC | |||
Remark | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-49 into parental strain CB4088. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTGCTTTTGGCTGTTTTCTGCATTGCTGCCTAT. Right flanking sequence: CCTGGGCTGATGGGgtatgttccaatattgaacc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGCATTGCTGCCTATGCCT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. | Inferred_automatically | From CGC strain data | |
Made_by: Heenam Park | CGC_data_submission | |||
Species | Caenorhabditis elegans |