WormBase Tree Display for Strain: WBStrain00055534
expand all nodes | collapse all nodes | view schema
WBStrain00055534 | Genotype | '+/mT1 [umnIs52] II; famh-136(hd7024[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. | ||
---|---|---|---|---|
Public_name | RG5059 | |||
Contains | Gene (5) | |||
Variation | WBVar00142982 | |||
Rearrangement | mT1 | |||
Transgene | WBTransgene00033218 | |||
Properties | Outcrossed | x5 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 12 Jun 2023 00:00:00 | |||
Location | CGC | |||
Made_by | WBPerson14989 | |||
Remark | umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7024 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7027 and CGC66. hd7024 is a 542 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTGAGCTTTAGCTATCTTCCTTTATCCT; Right flanking sequence: ATCACAGGTGTGAAGATTTATTAAATTTTA. sgRNA #1: ATGAATGACGCAAGAATTAA; sgRNA #2: TCTGAATACTTATTGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
Species | Caenorhabditis elegans |