WormBase Tree Display for Transgene: WBTransgene00000342

WBTransgene00000342 Public_name: cgc7122Is1
  Summary: [flr-4::gfp]
  Construction: Construct: WBCnstr00000342
    Integration_method: Spontaneous
  Construction_summary: The flr-4::GFP fusion gene pMTG7 was expressed in wild-type animals. This construct fully rescued all the flr-4 phenotypes, which indicates that the product was functional and present at a proper time in the cells that require the FLR-4 function for the wild-type phenotypes. The plasmid pMTG7 is comprised of the flr-4 rescuing construct with the carboxy terminus tagged with GFP through a linker sequence. It was constructed by the following procedures. 1) A 420-base pair fragment, corresponding to the 3' part of flr-4 gene, was amplified from pMT11 (minimal rescuing genomic DNA clone) using the primers f4-PK522 (CCTGCAGGGTACCCACCTCATTTATAGTGCGGC) and f4-BG320 (GGGATCCACCGTTTTCTTCATTTGCTGGTCCAGACG), and cloned into a T-vector. The primer f4-PK522 contained a PstI site and a KpnI site located side by side, and f4-BG320 contained the 3' end of the flr-4 coding sequence, a linker sequence and a BamHI site to connect to GFP. 2) The PstI-BamHI fragment of this clone was ligated to the PstI-BamHI-digested pQE9 vector (QIAGEN, Chatsworth, CA). 3) The KpnI-BssHII fragment (99 base pairs) of this clone was replaced by the 7.0-kb KpnI-BssHII fragment of pMT11, which contained a 3.5-kb 5' upstream region and the coding region of flr-4 gene, except for a short 3' part. 4) The 7.4-kb PstI-BamHI fragment of this clone, i.e., complete flr-4 gene with a 3.5-kb 5-Al upstream region and a 3l linker sequence, was ligated into the PstI-BamHI digested pPD95.77E1 to make pMTG7, where pPD95.77E1 is an improved version of the gfp vector pPD95.77 producing a brighter GFP (F64L S65T). --precise ends.
  Genetic_information: Integrated
  Used_for: Expr_pattern: Expr3717
  Reference: WBPaper00025117
  Species: Caenorhabditis elegans