WormBase Tree Display for Transgene: WBTransgene00005423
expand all nodes | collapse all nodes | view schema
| WBTransgene00005423 | Public_name | kxEx41 | |
|---|---|---|---|
| Summary | [Pglo-3::GLO-3-GFP; rol-6(su1006)] | ||
| Construction | Construct | WBCnstr00005355 | |
| Coinjection_other | rol-6(su1006) | ||
| Construction_summary | F59F5.2. Translational fusion with a carboxy terminally tagged GLO-3::GFP fusion expressed under the control of the glo-3 promoter. The rescuing translational reporter GLO-3::GFP made using the glo-3 genomic sequence was constructed using PCR fusion by amplifying the genomic region containing the glo-3 promoter and coding sequence from the cosmid F59F5 using P411 5' TCACTTTGCCTTCTGTGCGAGTTG 3' and P422 5' AGTCGACCTGCAGGCATGCAAGCTTTTTAACTGTTTTAACACGCATTC 3'. The gfp coding sequence and flanking unc-54 3'-UTR was amplified from pPD95.75 (Addgene) using P399 5' AGCTTGCATGCCTGCAGGTCGACT 3' and P266 5' AAGGGCCCGTACGGCCGACTAGTAGG 3'. The two PCR products were fused using P413 5' TCCAGATTAAAACGTCACAAGCAACCG 3' and P267 5' GGAAACAGTTATGTTTGGTATATTGGG 3'. --precise ends. | ||
| Genetic_information | Extrachromosomal | ||
| Used_for | Expr_pattern | Expr8336 | |
| Reference | WBPaper00032168 | ||
| Species | Caenorhabditis elegans |
