WormBase Tree Display for Transgene: WBTransgene00008688
expand all nodes | collapse all nodes | view schema
| WBTransgene00008688 | Public_name | oxEx593 | |
|---|---|---|---|
| Summary | [Pmca-3::GFP] | ||
| Construction | Construct | WBCnstr00008391 | |
| Construction_summary | Clone = pEB73. This construct consists of a 2.5-kb region upstream of mca-3 ATG, amplified from genomic wild-type DNA with oligos oEB232 [AATTCTGCAGCACAATGGCTACAGTAGCC] and oEB237 [TTCTACCGGTACCCGAAGCTCCTCCAGTGATG]. These primers append PstI and AgeI restriction sites, respectively. The promoter fragment was then inserted into a PstI and AgeI digested Fire lab vector pPD95.75 to produce a transcriptional GFP fusion. | ||
| Genetic_information | Extrachromosomal | ||
| Used_for | Expr_pattern | Expr8320 | |
| Expr12128 | |||
| Reference | WBPaper00029172 | ||
| Species | Caenorhabditis elegans |
