WormBase Tree Display for Transgene: WBTransgene00009943
expand all nodes | collapse all nodes | view schema
WBTransgene00009943 | Public_name | eeIs611_WBPaper00040410 | |
---|---|---|---|
Summary | [unc-119(+); hpl-1::eyfp] | ||
Construction | Construct | WBCnstr00009603 | |
Integration_method | Particle_bombardment | ||
Construction_summary | The hpl-1 gene was amplified by PCR from cosmid clone K08H2.6 using the primers ESMG57 GGGGTACCTCAATAAAGCGACGACAGATGTAAACA and ESMG59 CGGGATCCGCGCTCATTCCTCCTGGGATGGTTGG. The resulting 4.6 kb PCR product was cut with KpnI and BamHI and cloned into pEYFP-N1 (Clontech). The resulting plasmid was supplemented with C. elegans wild type unc-119 gene that wasobtained as an XbaI-HindIII-fragment from plasmid pMM016 and inserted into the NheI and HindIII sites. | ||
Genetic_information | Integrated | ||
Associated_with | Strain | WBStrain00042769 | |
Reference | WBPaper00040410 | ||
Species | Caenorhabditis elegans |