WormBase Tree Display for Transgene: WBTransgene00015448
expand all nodes | collapse all nodes | view schema
WBTransgene00015448 | Public_name | WBPaper00024232Ex7 | |
---|---|---|---|
Summary | [Y39A3B.5::GFP] | ||
Synonym | Expr10065_Ex | ||
Construction | Construct | WBCnstr00015037 | |
Construction_summary | PCR fusions were generated according to Hobert (2002). PCR fragment first cloned 3' to 5' into pCR-XL-TOPO vector (Invitrogen) 5' primer GAGCCTAAGCCTAAGCCTA 3' primer GCAGGCATGCAAGCTCATTGTGGTGGATAAACTG then EcoRV (TOPO vector)/SphI (3' primer) fragment cloned into pPD95.75 (HindIII, blunted and SphI). --precise ends. | ||
Genetic_information | Extrachromosomal | ||
Used_for | Expr_pattern | Expr10065 | |
Reference | WBPaper00024232 | ||
Species | Caenorhabditis elegans |