WormBase Tree Display for Transgene: WBTransgene00015753
expand all nodes | collapse all nodes | view schema
WBTransgene00015753 | Public_name | stIs10526 | |
---|---|---|---|
Summary | [T22C8.3::H1-wCherry + unc-119(+)] | ||
Synonym | [pJIM20_T22C8.3prom::his-24::mCherry] | ||
Construction | Construct | WBCnstr00015329 | |
Integration_method | Particle_bombardment | ||
Construction_summary | "PCR primers were designed to amplify the upstream intergenic sequences (UIS) by using the program Primer3 (Rozen and Skaletsky 1998). For genes with short UIS, a minimum target length of 2250 base pairs was used and for genes with long UIS a maximum target length of 5750kb was used. Primer3 was used to pick the best distal primer within 250bp of the target and fixed the proximal primer by anchoring it at the translation start site (including up to 6aa of the endogenous protein, which increased PCR success rates). Each UIS PCR product was cloned into pJIM20 (containing a cloning site followed by histone-mCherry and a permissive let-858 3' UTR) (Murray et al. 2008) using standard cloning methods. The resulting plasmid was used to generate transgenic C. elegans by microparticle bombardment of the strain CB4845[unc-119(ed3)] (Praitis et al. 2001). left/right primers tattttgcttcctctatgacagttgcgt/ttgttcggtggttgccatgact" | ||
Genetic_information | Integrated | ||
Associated_with | Strain | WBStrain00033651 | |
Reference | WBPaper00040986 | ||
Species | Caenorhabditis elegans |