Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Transgene: WBTransgene00016198

expand all nodes | collapse all nodes | view schema

Name Class

WBTransgene00016198Public_nameWBPaper00041467Ex1
Summary[Psid-3::gfp::sid-3 3' UTR]
SynonymExpr10570_Ex
ConstructionConstructWBCnstr00015763
Construction_summaryThe 3' UTR of sid-3 was amplified from gDNA with primers 5' ggcatggatgaactatacaaataggccaagaaactaatgtattatag 3' and 5' ccagcaaagagagattgctc 3'. The gfp coding sequence was amplified from pJM46a using primers 5' cattttcaggaggacccttg 3' and 5' ctataatacattagtttcttggcctatttgtatagttcatccatgc 3'. The fusion product gfp::sid-3 3' UTR was generated with primers 5' tcacttccctgtgtaaggtc 3' and 5' ctgccattttcagacgtagcaatgagtaaaggagaagaacttttc 3'. The sid-3 promoter was amplified from gDNA using ELT polymerase and with primers 5' ttgatgtgcaagccatctgg 3' and 5' gaaaagttcttctcctttactcattgctacgtctgaaaatggcag 3'. The final fusion product Psid-3::gfp::sid-3 3' UTR was generated with primers 5' ctgaaaggagcaacaagcac 3' and 5' gtgaccaaaaaagtagccgg 3'.
Genetic_informationExtrachromosomal
Used_forExpr_patternExpr10570
ReferenceWBPaper00041467
SpeciesCaenorhabditis elegans