WormBase Tree Display for Transgene: WBTransgene00016198
expand all nodes | collapse all nodes | view schema
WBTransgene00016198 | Public_name | WBPaper00041467Ex1 | |
---|---|---|---|
Summary | [Psid-3::gfp::sid-3 3' UTR] | ||
Synonym | Expr10570_Ex | ||
Construction | Construct | WBCnstr00015763 | |
Construction_summary | The 3' UTR of sid-3 was amplified from gDNA with primers 5' ggcatggatgaactatacaaataggccaagaaactaatgtattatag 3' and 5' ccagcaaagagagattgctc 3'. The gfp coding sequence was amplified from pJM46a using primers 5' cattttcaggaggacccttg 3' and 5' ctataatacattagtttcttggcctatttgtatagttcatccatgc 3'. The fusion product gfp::sid-3 3' UTR was generated with primers 5' tcacttccctgtgtaaggtc 3' and 5' ctgccattttcagacgtagcaatgagtaaaggagaagaacttttc 3'. The sid-3 promoter was amplified from gDNA using ELT polymerase and with primers 5' ttgatgtgcaagccatctgg 3' and 5' gaaaagttcttctcctttactcattgctacgtctgaaaatggcag 3'. The final fusion product Psid-3::gfp::sid-3 3' UTR was generated with primers 5' ctgaaaggagcaacaagcac 3' and 5' gtgaccaaaaaagtagccgg 3'. | ||
Genetic_information | Extrachromosomal | ||
Used_for | Expr_pattern | Expr10570 | |
Reference | WBPaper00041467 | ||
Species | Caenorhabditis elegans |