WormBase Tree Display for Transgene: WBTransgene00018365
expand all nodes | collapse all nodes | view schema
| WBTransgene00018365 | Public_name | WBPaper00038246Ex3 | |
|---|---|---|---|
| Summary | [UNC-38::YFP] | ||
| Synonym | Expr10822_Ex | ||
| Construction | Construct | WBCnstr00017750 | |
| Construction_summary | A 4.3 kb genomic region that contained 1.2 kb upstream of the unc-38 ATG and all unc-38 introns and exons up to the stop codon was PCR amplified with the following primers: 5'GGGGACAAGTTTGTACAAAAAAGCAGGCTGGCGGAGGAGTGCTGTTGGGAGCCAT3' and 5'GGGGACCACTTTGTACAAGAAAGCTGGGTTGAAACTAATTGGATTAGCAGATAAATTGG3'. -- precise ends. | ||
| Genetic_information | Extrachromosomal | ||
| Used_for | Expr_pattern | Expr10822 | |
| Reference | WBPaper00038246 | ||
| Species | Caenorhabditis elegans |
