WormBase Tree Display for Transgene: WBTransgene00019515
expand all nodes | collapse all nodes | view schema
| WBTransgene00019515 | Public_name | WBPaper00041467Ex3 | |
|---|---|---|---|
| Summary | [Psid-3::sid-3gDNA::DsRed2::sid-3 3'UTR] | ||
| Synonym | Expr10570_Ex | ||
| [SID-3::DsRed] | |||
| Construction | Construct | WBCnstr00018849 | |
| Construction_summary | The sid-3 3' UTR was amplified from gDNA with primers 5' ccaccacctgttcctgtaggccaagaaactaatgtattatag 3' and 5' ccagcaaagagagattgctc 3'. The DsRed2 coding sequence was amplified from pHC183 with primers 5' cattttcaggaggacccttg 3' and 5' ctataatacattagtttcttggcctacaggaacaggtggtgg 3'. The fusion product gfp::sid-3 3' UTR was generated with primers 5' ctgccattttcagacgtagcaatggcctcctccgagaacg 3' and 5' tcacttccctgtgtaaggtc 3'. The sid-3 promoter along with sid-3 was amplified from gDNA with primers 5' ttgatgtgcaagccatctgg 3' and 5' cgttctcggaggaggccatgccgagcaacatgttggcg 3'. The final fusion product, Psid- 3::sid-3::DsRed2::sid-3 3' UTR, was generated with primers 5' ctgaaaggagcaacaagcac 3' and 5' gtgaccaaaaaagtagccgg 3'. |[SID-3::GFP] translational fusion: the gfp coding sequence was amplified from pPD95.75 with primers 5' ctataatacattagtttcttggcctatttgtatagttcatccatgc 3' and 5' cgccaacatgttgctcggcatgagtaaaggagaagaacttttc 3' using Phusion polymerase mix (New England Biolabs). The sid-3 3' UTR was amplified from gDNA with primers 5' ccagcaaagagagattgctc 3' and 5' ggcatggatgaactatacaaataggccaagaaactaatgtattatag 3' using Phusion polymerase mix. The sid-3 promoter along with sid-3 was amplified from gDNA with primers 5' ttgatgtgcaagccatctgg 3' and 5' gaaaagttcttctcctttactcatgccgagcaacatgttggcg 3' using ELT polymerase. | ||
| Genetic_information | Extrachromosomal | ||
| Used_for | Expr_pattern | Expr10570 | |
| Reference | WBPaper00041467 | ||
| Species | Caenorhabditis elegans |
