WormBase Tree Display for Expr_pattern: Expr5055
expand all nodes | collapse all nodes | view schema
Expr5055 | Expression_of | Gene | WBGene00000182 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000182 | ||
Homol | Homol_homol | B0336:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003679 | ||
WBbt:0003681 | |||
WBbt:0003822 | |||
WBbt:0003833 | |||
WBbt:0004292 | |||
WBbt:0004506 | |||
WBbt:0004520 | |||
WBbt:0005107 | |||
WBbt:0005300 | |||
WBbt:0005319 | |||
WBbt:0005733 | |||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005753 | |||
WBbt:0005772 | |||
WBbt:0005800 | |||
WBbt:0005813 | |||
WBbt:0005828 | |||
WBbt:0006748 | |||
WBbt:0006749 | |||
WBbt:0006750 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
WBbt:0006769 | |||
Type | Reporter_gene | [arf-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCCGTTTATTATTGTTGCCTAT] 3' and primer B 5' [CCGAACACGTTTCCGATT] 3'. | |
Pattern | Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; labial sensilla; neurons along body; tail neurons; | ||
Larval Expression: pharynx; intestine; stomato-intestinal muscle; body wall muscle; Nervous System; head neurons; labial sensilla; tail neurons; | |||
Remark | Also expressed in (comments from author) : possibly labial sensillia in head. Hard to see because GFP in other tissues is masking things. | ||
Strain: BC12796 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003017 |