Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5067

expand all nodes | collapse all nodes | view schema

Name Class

Expr5067Expression_ofGeneWBGene00004498
Reflects_endogenous_expression_ofWBGene00004498
HomolHomol_homolB0412:Expr
Expression_data (2)
TypeReporter_gene[rps-29::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCGAAAATCTGAAATGCC] 3' and primer B 5' [CCGATTGTCGAGAGCTGAA] 3'.
PatternAdult Expression: pharynx; body wall muscle; excretory cell; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; stomato-intestinal muscle; Reproductive System; developing vulva; gonad sheath cells; body wall muscle; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons;
RemarkStrain: BC12819
ReferenceWBPaper00006525
TransgeneWBTransgene00003030