Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5071

expand all nodes | collapse all nodes | view schema

Name Class

Expr5071Expression_ofGeneWBGene00015181
Reflects_endogenous_expression_ofWBGene00015181
Expression_dataLife_stage (2)
Anatomy_term (13)
TypeReporter_gene[B0416.5b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATTCGATGGTTCTTCCACG] 3' and primer B 5' [AGCGCCGATTTTGCTTTT] 3'.
PatternAdult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells;
Larval Expression: pharynx; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; unidentified cells;
RemarkStrain: BC10419
ReferenceWBPaper00006525
TransgeneWBTransgene00002241