Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5085

expand all nodes | collapse all nodes | view schema

Name Class

Expr5085Expression_ofGeneWBGene00015248
Reflects_endogenous_expression_ofWBGene00015248
HomolHomol_homolB0546:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (22)
TypeReporter_gene[B0546.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAAAGCACCGAAGACGTA] 3' and primer B 5' [CTTGAAACGCTGAGGATTCTG] 3'.
PatternAdult Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; vulval muscle; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; unidentified cells in tail ;
Larval Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; unidentified cells in tail ;
Picture (3)
RemarkStrain: BC14118
ReferenceWBPaper00006525
TransgeneWBTransgene00003408