Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5108

expand all nodes | collapse all nodes | view schema

Name Class

Expr5108Expression_ofGeneWBGene00015344
Reflects_endogenous_expression_ofWBGene00015344
HomolHomol_homolK10C9:Expr
Expression_dataLife_stage (2)
Anatomy_term (16)
TypeReporter_gene[C02E11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGTTCCCGACAAAAATATGG] 3' and primer B 5' [TAAAGAACCGATGATCTGGAAAA] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells;
Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells;
PictureWBPicture0000009138
RemarkAlso expressed in (comments from author) : Whole animal has high intensity GFP.
Strain: BC12279
ReferenceWBPaper00006525
TransgeneWBTransgene00004284