WormBase Tree Display for Expr_pattern: Expr5110
expand all nodes | collapse all nodes | view schema
Expr5110 | Expression_of | Gene | WBGene00015344 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015344 | ||
Homol | Homol_homol | K10C9:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [C02E11.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAGGTCAAATTTTCGTCGATT] 3' and primer B 5' [TAAAGAACCGATGATCTGGAAAA] 3'. | |
Pattern | Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; tail neurons; | ||
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |||
Picture | WBPicture0000009139 | ||
WBPicture0000009140 | |||
WBPicture0000009141 | |||
Remark | Also expressed in (comments from author) : high intensity GFP, other tissues may be masked | ||
Strain: BC12752 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004382 |