Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5122

expand all nodes | collapse all nodes | view schema

Name Class

Expr5122Expression_of (2)
HomolHomol_homolC03C10:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (13)
TypeReporter_gene[C03C10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAAGTTTTCGTGAATCCTCCT] 3' and primer B 5' [ATTGTTTGCTCTGATCGTGCT] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells;
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells;
PictureWBPicture0000009153
RemarkAlso expressed in (comments from author) : High intensity GFP, therefore hard to distinguish some tissues... there might be excretory cell expression; the neural analysis carries some uncertainty.
Strain: BC10439
ReferenceWBPaper00006525
TransgeneWBTransgene00002258