WormBase Tree Display for Expr_pattern: Expr5143
expand all nodes | collapse all nodes | view schema
Expr5143 | Expression_of | Gene | WBGene00005093 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00005093 | ||
Homol | Homol_homol | C04E6:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (9) | |||
Type | Reporter_gene | [srd-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGTCTTTTTCTATCGACGAGC] 3' and primer B 5' [TCTTGTGCGATTCTGACAAATTA] 3'. | |
Pattern | Adult Expression: pharynx; intestine; Reproductive System; spermatheca uterine valve; Nervous System; head neurons; tail neurons; phasmids; | ||
Larval Expression: intestine; Reproductive System; Nervous System; head neurons; tail neurons; phasmids; unidentified cells in body ; | |||
Picture | WBPicture0000009177 | ||
WBPicture0000009178 | |||
WBPicture0000009179 | |||
Remark | Also expressed in (comments from author) : Expression in 2 non-DiI stained head neuron pairs between anterior and posterior pharyngeal bulbs, sending dendrites to tip of nose (Hober Lab apr 2005). | ||
Strain: BC15142 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003866 |