WormBase Tree Display for Expr_pattern: Expr5143
expand all nodes | collapse all nodes | view schema
Expr5143 | Expression_of | Gene | WBGene00005093 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00005093 | ||||
Homol | Homol_homol | C04E6:Expr | |||
Expression_data | Life_stage (2) | ||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005735 | |||||
WBbt:0005738 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005772 | |||||
WBbt:0006751 | |||||
WBbt:0006753 | |||||
WBbt:0006756 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [srd-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGTCTTTTTCTATCGACGAGC] 3' and primer B 5' [TCTTGTGCGATTCTGACAAATTA] 3'. | |||
Pattern | Adult Expression: pharynx; intestine; Reproductive System; spermatheca uterine valve; Nervous System; head neurons; tail neurons; phasmids; | ||||
Larval Expression: intestine; Reproductive System; Nervous System; head neurons; tail neurons; phasmids; unidentified cells in body ; | |||||
Picture | WBPicture0000009177 | ||||
WBPicture0000009178 | |||||
WBPicture0000009179 | |||||
Remark | Also expressed in (comments from author) : Expression in 2 non-DiI stained head neuron pairs between anterior and posterior pharyngeal bulbs, sending dendrites to tip of nose (Hober Lab apr 2005). | ||||
Strain: BC15142 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00003866 |