Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5177

expand all nodes | collapse all nodes | view schema

Name Class

Expr5177Expression_ofGeneWBGene00002062
Reflects_endogenous_expression_ofWBGene00002062
HomolHomol_homolC05D9:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (24)
TypeReporter_gene[ife-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACAGCTAATTGCGAAGAATGAA] 3' and primer B 5' [ACGTTTCAGCTTCGATCTCTG] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons;
Picture (6)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC15051
ReferenceWBPaper00006525
TransgeneWBTransgene00003840