WormBase Tree Display for Expr_pattern: Expr5203

Expr5203 Expression_of: Gene: WBGene00015580
    Reflects_endogenous_expression_of: WBGene00015580
  Homol: Homol_homol: C07H6:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term (13)
  Type: Reporter_gene: [C07H6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGGAATTGAGTTGGCACTCT] 3' and primer B 5' [GTTGGTGTCGATCAGGTGG] 3'.
  Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; Reproductive System; uterus; uterine-seam cell; vulva other; spermatheca; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ;
    Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; uterine-seam cell; unidentified cells in head; unidentified cells in tail ;
  Picture: WBPicture0000003755
    WBPicture0000003756
    WBPicture0000009194
  Remark: Also expressed in (comments from author) : Pharynx expression is the MARGINAL CELLS (Hall Lab, 2005).unidentified cells in tail and head head is possibly neural, low intensity GFP.
    Strain: BC12754
  Reference: WBPaper00006525
  Transgene: WBTransgene00004488