Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5261

expand all nodes | collapse all nodes | view schema

Name Class

Expr5261Expression_of (2)
HomolHomol_homolC13G3:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (11)
TypeReporter_gene[C13G3.3b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGTTCCGCAGACGC] 3' and primer B 5' [TGCAGGAATGATATCTCCTAGAAA] 3'.
PatternAdult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkStrain: BC14496
ReferenceWBPaper00006525
TransgeneWBTransgene00003575