WormBase Tree Display for Expr_pattern: Expr5292
expand all nodes | collapse all nodes | view schema
| Expr5292 | Expression_of | Gene | WBGene00015926 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00015926 | ||
| Homol | Homol_homol | C17H11:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term (13) | |||
| Type | Reporter_gene | [C17H11.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTAAAAATGTTTGCGCCG] 3' and primer B 5' [CGTCGCTGTATGACCAACC] 3'. | |
| Pattern (2) | |||
| Picture | WBPicture0000003895 | ||
| WBPicture0000003896 | |||
| WBPicture0000003897 | |||
| Remark | Also expressed in (comments from author) : Neural in tail are the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). | ||
| Strain: BC13998 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003363 |
