WormBase Tree Display for Expr_pattern: Expr5303
expand all nodes | collapse all nodes | view schema
Expr5303 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | C18D11:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003679 | ||
WBbt:0003681 | |||
WBbt:0003822 | |||
WBbt:0003833 | |||
WBbt:0005733 | |||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005813 | |||
WBbt:0005821 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'. | |
Pattern | Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; Nervous System; head neurons; neurons along body; unidentified cells; | ||
Larval Expression: pharynx; body wall muscle; hypodermis; Nervous System; head neurons; neurons along body; unidentified cells; | |||
Remark | Also expressed in (comments from author) : Might have seen seam cells but we were unsure. | ||
Strain: BC12525 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004293 |