WormBase Tree Display for Expr_pattern: Expr5305
expand all nodes | collapse all nodes | view schema
| Expr5305 | Expression_of | Gene | WBGene00004705 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00004705 | ||
| Homol | Homol_homol | C18D11:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term (15) | |||
| Type | Reporter_gene | [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'. | |
| Pattern | Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; | ||
| Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing gonad; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; | |||
| Remark | Also expressed in (comments from author) : Unidentified cells in head and tail, possibly neural. | ||
| Strain: BC10484 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002279 |
