Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5313

expand all nodes | collapse all nodes | view schema

Name Class

Expr5313Expression_ofGeneWBGene00004507
Reflects_endogenous_expression_ofWBGene00004507
HomolHomol_homolT14B4:Expr
Expression_data (2)
TypeReporter_gene[rpy-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTTTGCAATGATTTTTCAAGTC] 3' and primer B 5' [CGTCGATGATTCGTGATGAG] 3'.
PatternAdult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons;
Larval Expression: stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkAlso expressed in (comments from author) : Beautiful intestinal muscle.
Strain: BC10720
ReferenceWBPaper00006525
TransgeneWBTransgene00002295