Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5333

expand all nodes | collapse all nodes | view schema

Name Class

Expr5333Expression_ofGeneWBGene00007707
Reflects_endogenous_expression_ofWBGene00007707
HomolHomol_homolC25A1:Expr
Expression_data (2)
TypeReporter_gene[C25A1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTGTTCCACTCATCTCTTCG] 3' and primer B 5' [TATCCCGATATTTTCCACTGAAAT] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca uterine valve; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons;
RemarkStrain: BC15292
ReferenceWBPaper00006525
TransgeneWBTransgene00003922