Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5390

expand all nodes | collapse all nodes | view schema

Name Class

Expr5390Expression_ofGeneWBGene00016258
Reflects_endogenous_expression_ofWBGene00016258
HomolHomol_homolC30F8:Expr
Expression_data (2)
TypeReporter_gene[C30F8.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTTTGCAACGCACTTTTT] 3' and primer B 5' [TGTGAAAATCGGGGGAAAG] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulval muscle; hypodermis; excretory cell; Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; hypodermis; excretory cell; Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head; unidentified cells in tail ;
RemarkStrain: BC10190
ReferenceWBPaper00006525
TransgeneWBTransgene00002130